1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265
//! The `rosalind` crate provides fuctions to solve probles from [Rosalind](http://rosalind.info/) site. //! //! # Counting DNA Nucleotides //! ## Examples //! ``` //! use rosalind::RosalindError::UnknownNucleotide; //! use rosalind::dna::*; //! //! let dna = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"; //! let dna_nucleotides = DNANucleotides {A: 20, C: 12, G: 17, T: 21}; //! assert_eq!(count_dna_nucleotides(dna).unwrap(), dna_nucleotides); //! assert_eq!(dna_nucleotides.to_string(), "20 12 17 21"); //! assert_eq!(count_dna_nucleotides("\n").unwrap(), DNANucleotides {A: 0, C: 0, G: 0, T: 0}); //! assert_eq!(count_dna_nucleotides("Z").unwrap_err(), UnknownNucleotide('Z')); //! ``` //! //! # Transcribing DNA into RNA //! ## Examples //! ``` //! use rosalind::RosalindError::UnknownNucleotide; //! use rosalind::rna::*; //! //! let dna = "GATGGAACTTGACTACGTAAATT"; //! assert_eq!(transcribe_dna_into_rna(dna).unwrap(), "GAUGGAACUUGACUACGUAAAUU"); //! assert_eq!(transcribe_dna_into_rna("\n").unwrap(), ""); //! assert_eq!(transcribe_dna_into_rna("Z").unwrap_err(), UnknownNucleotide('Z')); //! ``` //! //! # Complementing a Strand of DNA //! ## Examples //! ``` //! use rosalind::RosalindError::UnknownNucleotide; //! use rosalind::revc::*; //! //! let dna = "AAAACCCGGT"; //! assert_eq!(reverse_complement_dna(dna).unwrap(), "ACCGGGTTTT"); //! assert_eq!(reverse_complement_dna("\n").unwrap(), ""); //! assert_eq!(reverse_complement_dna("Z").unwrap_err(), UnknownNucleotide('Z')); //! ``` //! //! # Rabbits and Recurrence Relations //! ## Examples //! ``` //! # #[macro_use] extern crate num; //! # #[macro_use] extern crate rosalind; //! # fn main() { //! use rosalind::fib::*; //! use num::{BigUint}; //! use num::bigint::{ToBigUint}; //! //! let mut expected_relation: BigUint = 19.to_biguint().unwrap(); //! assert_eq!(recurrence_relation(5, 3).unwrap(), expected_relation); //! expected_relation = 4.to_biguint().unwrap(); //! assert_eq!(recurrence_relation_with_stop(6, 3).unwrap(), expected_relation); //! # } //! ``` //! //! # Translating RNA into Protein, Inferring mRNA from Protein, Calculating Protein Mass //! ## Examples //! ``` //! use rosalind::RosalindError::{CodonParseError, UnknownCodon, UnknownAminoAcid}; //! use rosalind::prot::*; //! //! let rna = "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"; //! assert_eq!(translate_rna_into_protein(rna).unwrap(), "MAMAPRTEINSTRING"); //! assert_eq!(translate_rna_into_protein("AUGUGA\n").unwrap(), "M"); //! assert_eq!(translate_rna_into_protein("Z").unwrap_err(), CodonParseError); //! assert_eq!(translate_rna_into_protein("ZZZ").unwrap_err(), UnknownCodon("ZZZ".to_string())); //! //! assert_eq!(get_number_of_rna_from_protein("MA").unwrap(), 12); //! assert_eq!(get_number_of_rna_from_protein("").unwrap(), 0); //! assert_eq!(get_number_of_rna_from_protein("\n").unwrap(), 3); //! assert_eq!(get_number_of_rna_from_protein("B").unwrap_err(), UnknownAminoAcid('B')); //! //! assert_eq!(get_protein_mass("SKADYEK\n").unwrap(), 821.392f64); //! assert_eq!(get_protein_mass("AB").unwrap_err(), UnknownAminoAcid('B')); //! ``` //! //! # Counting Point Mutations //! ## Examples //! ``` //! use rosalind::RosalindError::HammingStringsLengthError; //! use rosalind::hamm::*; //! //! let s = "GAGCCTACTAACGGGAT"; //! let t = "CATCGTAATGACGGCCT"; //! assert_eq!(hamming_distance(s, t).unwrap(), 7); //! assert_eq!(hamming_distance("G", "").unwrap_err(), HammingStringsLengthError); //! ``` //! //! # Finding a Motif in DNA //! ## Examples //! ``` //! use rosalind::RosalindError::MotifStringsLengthError; //! use rosalind::subs::*; //! //! let s = "GATATATGCATATACTT"; //! let t = "ATAT"; //! assert_eq!(motif_lookup(s, t).unwrap(), vec![2, 4, 10]); //! assert_eq!(motif_lookup(t, s).unwrap_err(), MotifStringsLengthError); //! ``` //! //! # Computing GC Content //! ## Examples //! ``` //! use rosalind::gc::*; //! //! assert_eq!(gc_content("").unwrap(), 0f32); //! assert_eq!(gc_content("AGCTATAG").unwrap(), 37.5f32); //! //! let dataset = ">Rosalind_6404 //! CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC //! TCCCACTAATAATTCTGAGG //! >Rosalind_5959 //! CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT //! ATATCCATTTGTCAGCAGACACGC //! >Rosalind_0808 //! CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC //! TGGGAACCTGCGGGCAGTAGGTGGAAT"; //! //! assert_eq!(best_gc_content_in_dataset(dataset).unwrap(), //! GCcontent {string_id: "Rosalind_0808".to_string(), gc_content: 60.919540f32}); //! ``` //! //! # Mendel's First Law //! ## Examples //! ``` //! use rosalind::RosalindError::InvalidInputParameters; //! use rosalind::iprb::*; //! //! assert_eq!(dominant_allele_probability(0, 1, 1).unwrap_err(), InvalidInputParameters); //! assert_eq!(dominant_allele_probability(1, 0, 1).unwrap_err(), InvalidInputParameters); //! assert_eq!(dominant_allele_probability(1, 1, 0).unwrap_err(), InvalidInputParameters); //! //! assert_eq!(dominant_allele_probability(2, 2, 2).unwrap(), 0.7833333); //! ``` //! //! # Consensus and Profile //! ## Examples //! ``` //! use rosalind::cons::*; //! //! let prof = Profile { //! A: vec![5, 1, 0, 0, 5, 5, 0, 0], //! C: vec![0, 0, 1, 4, 2, 0, 6, 1], //! G: vec![1, 1, 6, 3, 0, 1, 0, 0], //! T: vec![1, 5, 0, 0, 0, 1, 1, 6], //! }; //! //! assert_eq!(consensus(prof).unwrap(), "ATGCAACT"); //! ``` //! //! # Utilities //! ## Parse FASTA dataset into list of Strings //! ``` //! use rosalind::utils::*; //! //! let fasta_dataset = ">Rosalind_1 //! CCTGCGGAAG //! TCCCACTAAT //! >Rosalind_2 //! CCATCGGTAG //! ATATCCATTT //! >Rosalind_3 //! CCACCCTCGT //! TGGGAACCTG"; //! //! let expected_dataset = vec![ //! "CCTGCGGAAGTCCCACTAAT", //! "CCATCGGTAGATATCCATTT", //! "CCACCCTCGTTGGGAACCTG", //! ]; //! //! assert_eq!(parse_fasta_dataset(fasta_dataset).unwrap(), expected_dataset); //! ``` extern crate num; use std::error::Error; use std::fmt; use std::result; use self::RosalindError::*; #[derive(PartialEq, Debug)] pub enum RosalindError { UnknownNucleotide(char), UnknownCodon(String), UnknownAminoAcid(char), CodonParseError, HammingStringsLengthError, MotifStringsLengthError, InvalidInputParameters, } impl fmt::Display for RosalindError { fn fmt(&self, f: &mut fmt::Formatter) -> fmt::Result { match *self { UnknownNucleotide(ref nucleotide) => write!(f, "{}: '{}'", self.description(), nucleotide), UnknownCodon(ref codon) => write!(f, "{}: '{}'", self.description(), codon), UnknownAminoAcid(ref amino_acid) => write!(f, "{}: '{}'", self.description(), amino_acid), _ => write!(f, "{}", self.description()), } } } impl Error for RosalindError { fn description(&self) -> &str { match *self { UnknownNucleotide(..) => "Unknown nucleotide", UnknownCodon(..) => "Unknown codon", UnknownAminoAcid(..) => "Unknown amino acid", CodonParseError => "Could not parse RNA string and group codons", HammingStringsLengthError => "Strings must have equal length", MotifStringsLengthError => "Substrig `t` must be no longer than `s`", InvalidInputParameters => "Invalid input parameters have been passed to the function" } } } /// Unified return type for all modules and methods of `rosalind` library /// /// ## Examples /// ``` /// use rosalind::RosalindResult; /// use rosalind::RosalindError::UnknownNucleotide; /// use rosalind::dna::count_dna_nucleotides; /// use rosalind::rna::transcribe_dna_into_rna; /// /// fn wrapper<T, U>(method: &Fn(U) -> RosalindResult<T>, args: U) -> RosalindResult<T> { /// method(args) /// } /// /// let result = wrapper(&transcribe_dna_into_rna, "GATGGAACTTGACTACGTAAATT"); /// assert_eq!(result.unwrap(), "GAUGGAACUUGACUACGUAAAUU"); /// /// let result = wrapper(&count_dna_nucleotides, "Z"); /// assert_eq!(result.unwrap_err(), UnknownNucleotide('Z')); /// ``` pub type RosalindResult<T> = result::Result<T, RosalindError>; pub mod dna; pub mod rna; pub mod revc; pub mod fib; pub mod prot; pub mod hamm; pub mod subs; pub mod gc; pub mod iprb; pub mod cons; pub mod constants; pub mod utils; #[cfg(test)] mod tests { use super::RosalindError; use super::RosalindError::CodonParseError; #[test] fn it_should_stringify_rosalind_error() { let error: RosalindError = CodonParseError; assert_eq!(error.to_string(), "Could not parse RNA string and group codons"); } }